Stem-loop sequence ssc-mir-30d

Accession

MI0013091 (change log)

Description

Sus scrofa miR-30d stem-loop

Gene family

MIPF0000005; mir-30

Literature search

17 open access papers mention ssc-mir-30d
(32 sentences)

Stem-loop

   -----cu  u  u         ccc           gua  ac 
5'        gu gu guaaacauc   gacuggaagcu   ag  a
          || || |||||||||   |||||||||||   ||   
3'        ca cg cguuuguag   cugacuuucga   uc  u
   ucucagc  c  u         --a           --a  ga 

Deep sequencing

39165 reads, 7.07e+03 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr4: 6713518-6713596 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ssc-mir-30d

• ssc-mir-30d: chr4: 6713518-6713596 [+]
• ssc-mir-30b: chr4: 6717643-6717718 [+]

Database links

• EntrezGene:MIR30D
• miRBase Tracker:MI0013091

Mature sequence ssc-miR-30d

• Accession: MIMAT0013871
• Sequence: 8 - uguaaacauccccgacuggaagcu - 31
• Deep sequencing: 39072 reads, 15 experiments
• Evidence: experimental; Illumina [1-3]

References

1. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).