Stem-loop sequence ssc-mir-320

Accession

MI0013097 (change log)

Description

Sus scrofa miR-320 stem-loop

Gene family

MIPF0000163; mir-320

Literature search

9 open access papers mention ssc-mir-320
(22 sentences)

Stem-loop

   gc       ---------         uu       c      g 
5'   uccccuc         cgccuucuc  cccgguu uucccg a
     |||||||         |||||||||  ||||||| ||||||  
3'   aggggag         gcgggagag  gggucga aagggc g
   -c       aaggaaaaa         uu       a      u 

Deep sequencing

6549 reads, 780 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr14: 6954934-6955013 [-]
• Overlapping transcripts:

  antisense

  ENSSSCT00000010548 ; POLR3D-201; 3'UTR (exon 1)

Database links

• EntrezGene:MIR320
• miRBase Tracker:MI0013097

Mature sequence ssc-miR-320

• Accession: MIMAT0013878
• Sequence: 43 - aaaagcuggguugagagggcgaa - 65
• Deep sequencing: 6542 reads, 15 experiments
• Evidence: experimental; Illumina [1-3]

References

1. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).