![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-10b |
|||||
Accession | MI0013102 (change log) | ||||
Description | Sus scrofa miR-10b stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
![]()
28 open access papers mention ssc-mir-10b | ||||
Stem-loop |
-- u a g c -ug au 5' g cuauauau cccu uagaa cgaauuugug gu c | |||||||| |||| ||||| |||||||||| || 3' c gguauaua gggg aucuu gcuuagacac ua c ag u a - a uga ca |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ssc-miR-10b |
|
Accession | MIMAT0013885 |
Sequence |
10 - uacccuguagaaccgaauuugu - 31 |
Deep sequencing | 118280 reads, 15 experiments |
Evidence | experimental; Illumina [1,3-4], cloned [2] |
References |
|
1 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
2 |
PMID:20180025
"Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
Mol Biol Rep. 37:3567-3574(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|