![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-92a-2 |
||||||||||||||
Accession | MI0013124 (change log) | |||||||||||||
Description | Sus scrofa miR-92a-2 stem-loop | |||||||||||||
Gene family | MIPF0000013; mir-25 | |||||||||||||
Literature search |
![]()
17 open access papers mention ssc-mir-92a-2 | |||||||||||||
Stem-loop |
cu a ug g uu u u guggu 5' uuc uccg ggu gggau gu gca uacuu g ||| |||| ||| ||||| || ||| ||||| 3' aag aggu ccg cccug ca cgu augaa u -a a gu g uu - u auaug |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence ssc-miR-92a |
|
Accession | MIMAT0013908 |
Sequence |
51 - uauugcacuugucccggccugu - 72 |
Deep sequencing | 36935 reads, 15 experiments |
Evidence | experimental; Illumina [1,3-4], cloned [2] |
References |
|
1 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
2 |
PMID:20180025
"Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
Mol Biol Rep. 37:3567-3574(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|