Stem-loop sequence ssc-mir-497

AccessionMI0013139 (change log)
DescriptionSus scrofa miR-497 stem-loop
Gene family MIPF0000231; mir-497
Literature search

2 open access papers mention ssc-mir-497
(8 sentences)

Stem-loop 
          - -----    g    c         u  --   ac 
5' cccgccc c     agca caca ugugguuug ac  ggc  u
   ||||||| |     |||| |||| ||||||||| ||  |||   
3' ggguggg g     uugu gugu acaccaaac ug  ccg  g
          a cgaga    g    c         c  ca   gu
Get sequence
Deep sequencing
1115 reads, 20 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 54717025-54717104 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-497
ssc-mir-497chr12: 54717025-54717104 [+]
ssc-mir-195chr12: 54717315-54717394 [+]
Database links

Mature sequence ssc-miR-497

Accession MIMAT0013926
Sequence

8 -  

cagcagcacacugugguuugu

 - 28

Get sequence
Deep sequencing1099 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).