Stem-loop sequence ssc-mir-574

AccessionMI0013161 (change log)
DescriptionSus scrofa miR-574 stem-loop
Gene family MIPF0000419; mir-574
Literature search

5 open access papers mention ssc-mir-574
(11 sentences)

Stem-loop 
   uggg            a u                 ug  gc 
5'     ugcgggcgugug g gugugugugugagugug  uc  u
       |||||||||||| | |||||||||||||||||  ||   
3'     acgcccgcacac c cacacacguacucgcac  gg  c
   ----            - -                 cu  gc
Get sequence
Deep sequencing
559 reads, 13.3 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr8: 31672459-31672538 [+]
sense
ENSSSCT00000009611 ; FAM114A1-201; intron 1
Database links

Mature sequence ssc-miR-574-5p

Accession MIMAT0037367
Sequence

15 -  

ugagugugugugugugagugugu

 - 37

Get sequence
Deep sequencing79 reads, 14 experiments
Evidence experimental; Illumina [5]

Mature sequence ssc-miR-574-3p

Accession MIMAT0013951
Sequence

51 -  

cacgcucaugcacacacccaca

 - 72

Get sequence
Deep sequencing479 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
5
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).