Stem-loop sequence rco-MIR159

AccessionMI0013378 (change log)
DescriptionRicinus communis miR159 stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention rco-MIR159
(4 sentences)

Stem-loop
   --ga            ga       ua        --ugau      auu     g     c    g uc      c     aag     au 
5'     guggagcuccuu  aguccaa  gaggaucu      ggguag   gagcu cugag uaug a  ccacag ccuau   cagag  u
       ||||||||||||  |||||||  ||||||||      ||||||   ||||| ||||| |||| |  |||||| |||||   |||||  a
3'     caucucgaggga  uuagguu  uuccuaga      uccauu   uucga gacuc auac u  gguguu ggaua   guuuu  u
   ucua            ag       ug        uuaugu      -ac     g     u    g uc      c     --g     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974757.1: 35526-35705 [-]
intergenic
Database links

Mature sequence rco-miR159

Accession MIMAT0014152
Sequence

155 - 

uuuggauugaagggagcucua

 - 175

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).