![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-980 |
|||||
Accession | MI0013449 (change log) | ||||
Description | Aedes aegypti miR-980 stem-loop | ||||
Gene family | MIPF0000890; mir-980 | ||||
Literature search |
2 open access papers mention aae-mir-980 | ||||
Stem-loop |
acu ucg g u u c gu 5' acaau gcc uucauuggg ca cuagcu gu u ||||| ||| ||||||||| || |||||| || g 3' uguua cgg aagugaucc gu gauuga ca g --- uaa g - c - aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was experimentally identified in the closely related Aedes albopictus, for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-980-5p |
|
Accession | MIMAT0014235 |
Previous IDs | aae-miR-980* |
Sequence |
10 - cggccguucauugggucaucuagc - 33 |
Deep sequencing | 26 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
Mature sequence aae-miR-980-3p |
|
Accession | MIMAT0014236 |
Previous IDs | aae-miR-980 |
Sequence |
50 - uagcugccuagugaagggc - 68 |
Deep sequencing | 1416 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|