Stem-loop sequence aae-mir-980

AccessionMI0013449 (change log)
DescriptionAedes aegypti miR-980 stem-loop
Gene family MIPF0000890; mir-980
Literature search

2 open access papers mention aae-mir-980
(6 sentences)

Stem-loop
   acu     ucg   g         u  u      c  gu 
5'    acaau   gcc uucauuggg ca cuagcu gu  u
      |||||   ||| ||||||||| || |||||| ||  g
3'    uguua   cgg aagugaucc gu gauuga ca  g
   ---     uaa   g         -  c      -  aa 
Get sequence
Deep sequencing
1443 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was experimentally identified in the closely related Aedes albopictus, for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome [1].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.23: 1043020-1043095 [+]
intergenic
Database links

Mature sequence aae-miR-980-5p

Accession MIMAT0014235
Previous IDsaae-miR-980*
Sequence

10 - 

cggccguucauugggucaucuagc

 - 33

Get sequence
Deep sequencing26 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence aae-miR-980-3p

Accession MIMAT0014236
Previous IDsaae-miR-980
Sequence

50 - 

uagcugccuagugaagggc

 - 68

Get sequence
Deep sequencing1416 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).