![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-2940 |
|||||
Accession | MI0013489 (change log) | ||||
Description | Aedes aegypti miR-2940 stem-loop | ||||
Literature search |
![]()
9 open access papers mention aae-mir-2940 | ||||
Stem-loop |
u a ag uuauuuuacc uuucuuuuc g 5' ca ugguuuaucuu ucugucg gcaag ggauagug guga c || ||||||||||| ||||||| ||||| |||||||| |||| 3' gu acuaaauagag ggacagc uguuc ccuaucac cacu a c - -- ---uucucga --------- a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was experimentally identified in the closely related Aedes albopictus, for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-2940-5p |
|
Accession | MIMAT0014283 |
Previous IDs | aae-miR-2940 |
Sequence |
4 - ugguuuaucuuaucugucgaggc - 26 |
Deep sequencing | 55498 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
Mature sequence aae-miR-2940-3p |
|
Accession | MIMAT0014284 |
Previous IDs | aae-miR-2940* |
Sequence |
87 - gucgacagggagauaaaucacu - 108 |
Deep sequencing | 24779 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|