Stem-loop sequence aae-mir-2940

AccessionMI0013489 (change log)
DescriptionAedes aegypti miR-2940 stem-loop
Literature search

9 open access papers mention aae-mir-2940
(56 sentences)

Stem-loop
     u           a       ag     uuauuuuacc        uuucuuuuc    g 
5' ca ugguuuaucuu ucugucg  gcaag          ggauagug         guga c
   || ||||||||||| |||||||  |||||          ||||||||         ||||  
3' gu acuaaauagag ggacagc  uguuc          ccuaucac         cacu a
     c           -       --     ---uucucga        ---------    a 
Get sequence
Deep sequencing
80278 reads, 4e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was experimentally identified in the closely related Aedes albopictus, for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome [1].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.222: 643957-644065 [+]
intergenic
Database links

Mature sequence aae-miR-2940-5p

Accession MIMAT0014283
Previous IDsaae-miR-2940
Sequence

4 - 

ugguuuaucuuaucugucgaggc

 - 26

Get sequence
Deep sequencing55498 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence aae-miR-2940-3p

Accession MIMAT0014284
Previous IDsaae-miR-2940*
Sequence

87 - 

gucgacagggagauaaaucacu

 - 108

Get sequence
Deep sequencing24779 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).