Stem-loop sequence aae-mir-2942

AccessionMI0013506 (change log)
DescriptionAedes aegypti miR-2942 stem-loop
Literature search

1 open access papers mention aae-mir-2942
(1 sentences)

Stem-loop
       -uu  c      c  u        ac     uacauug 
5' aaug   au aauucg ug ggucucga  guacc       g
   ||||   || |||||| || ||||||||  |||||        
3' uuac   ua uugagc ac ucagagcu  uaugg       a
       ccu  a      -  u        --     uuuuuau 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.245: 212398-212479 [+]
intergenic
Database links

Mature sequence aae-miR-2942

Accession MIMAT0014300
Sequence

53 - 

uauucgagacuucacgaguuaau

 - 75

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1