Stem-loop sequence aae-mir-2944b

AccessionMI0013510 (change log)
DescriptionAedes aegypti miR-2944b stem-loop
Gene family MIPF0001335; mir-2944
Literature search

4 open access papers mention aae-mir-2944b
(5 sentences)

Stem-loop
   aucga   -    c c g         uga 
5'      agg aacu c g ugugauaua   c
        ||| |||| | | |||||||||   u
3'      ucc uuga g c acacuauau   c
   uauag   a    u a g         uag 
Get sequence
Deep sequencing
252 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.464: 825313-825374 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-2944b
aae-mir-286asupercont1.464: 824995-825091 [+]
aae-mir-2944bsupercont1.464: 825313-825374 [+]
aae-mir-2944asupercont1.464: 825450-825511 [+]
aae-mir-309bsupercont1.464: 825629-825699 [+]
Database links

Mature sequence aae-miR-2944b-5p

Accession MIMAT0014304
Previous IDsaae-miR-2944b
Sequence

4 - 

gaaggaacucccggugugauaua

 - 26

Get sequence
Deep sequencing204 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence aae-miR-2944b-3p

Accession MIMAT0015373
Previous IDsaae-miR-2944b*
Sequence

38 - 

uaucacagcaguaguuaccuga

 - 59

Get sequence
Deep sequencing48 reads, 2 experiments
Evidence experimental; 454 [1]

References

1