Stem-loop sequence aae-mir-276-2

AccessionMI0013516 (change log)
DescriptionAedes aegypti miR-276-2 stem-loop
Gene family MIPF0000124; mir-276
Literature search

2 open access papers mention aae-mir-276-2
(5 sentences)

Stem-loop
   ---ggugaagugugcaguaauuagugccagguagguuagauuuccaguguc      u      uc    a     ag          cguuc       
5'                                                    ucgagu aauccg  agcg gguau  aguuccuaug     ggauaa 
                                                      |||||| ||||||  |||| |||||  ||||||||||     ||||| a
3'                                                    gguucg uuaggu  ucgu ccaua  ucaaggauac     cuuaua 
   cuacuaaauguuuaaucggugcuugaaggugguaaugggagagcuacugaa      -      uc    g     cu          -----       
Get sequence
Deep sequencing
722027 reads, 3.56e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.5: 2769446-2769635 [-]
intergenic
Database links

Mature sequence aae-miR-276-3p

Accession MIMAT0014223
Previous IDsaae-miR-276
Sequence

106 - 

uaggaacuucauaccgugcuc

 - 126

Get sequence
Deep sequencing1185313 reads, 2 experiments
Evidence experimental; 454 [1]

References

1