Stem-loop sequence aae-mir-317-2

AccessionMI0013524 (change log)
DescriptionAedes aegypti miR-317-2 stem-loop
Gene family MIPF0000144; mir-317
Literature search

2 open access papers mention aae-mir-317-2
(6 sentences)

Stem-loop
      a  uc      c       -   --     c     uugcau 
5' gga uu  ggcuac gggauac acc  cugug ucgcu      u
   ||| ||  |||||| ||||||| |||  ||||| |||||       
3' ccu aa  ccggug cucuaug ugg  gacac aguga      c
      -  uc      a       g   uc     a     ucaaag 
Get sequence
Deep sequencing
373144 reads, 1.8e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.265: 429451-429538 [+]
intergenic
Database links

Mature sequence aae-miR-317

Accession MIMAT0014224
Sequence

53 - 

ugaacacagcuggugguaucu

 - 73

Get sequence
Deep sequencing744670 reads, 2 experiments
Evidence experimental; 454 [1]

References

1