Stem-loop sequence cqu-mir-31

AccessionMI0013614 (change log)
DescriptionCulex quinquefasciatus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

1 open access papers mention cqu-mir-31
(2 sentences)

Stem-loop
   --------      -caacuu       u     c         agu 
5'         aauugg       ggcaaga guugg auagcugaa   u
           ||||||       ||||||| ||||| |||||||||   u
3'         uuaacc       cuguucu caacu uaucgauuu   u
   acaguuau      uuuuuau       u     -         gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.559: 256524-256610 [-]
intergenic
Database links

Mature sequence cqu-miR-31-5p

Accession MIMAT0014425
Previous IDscqu-miR-31
Sequence

12 - 

uggcaagauguuggcauagcuga

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-31-3p

Accession MIMAT0014426
Previous IDscqu-miR-31*
Sequence

48 - 

agcuauucaacuucuugucuau

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).