Stem-loop sequence cqu-mir-375-1

AccessionMI0013630 (change log)
Previous IDscqu-mir-375
DescriptionCulex quinquefasciatus miR-375-1 stem-loop
Gene family MIPF0000114; mir-375
Literature search

1 open access papers mention cqu-mir-375-1
(2 sentences)

Stem-loop
   gu   uaac      au   aguu    a         u   cg      ggc   g 
5'   gcc    aggagc  ccg    acuc agccggacg aac  aaacuu   ucu c
     |||    ||||||  |||    |||| ||||||||| |||  ||||||   ||| u
3'   ugg    ucuucg  ggc    ugag ucgguuugc uug  uuugag   agg g
   -g   ---u      --   guau    c         -   --      --a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.4: 25117-25222 [-]
intergenic
Database links

Mature sequence cqu-miR-375

Accession MIMAT0014443
Sequence

69 - 

uuuguucguuuggcucgaguua

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).