Dead miRNA entry

miRNA accession:
MI0013952
miRNA ID:
api-mir-996-2
Forward to:
MI0013951
Comment:
Two previously annotated mir-996 entries map to the same locus in the AphidBase2 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence api-mir-996-2

AccessionMI0013952 (change log)
DescriptionAcyrthosiphon pisum miR-996-2 stem-loop
Stem-loop
   --          u       g    -   au 
5'   acggguguag cuuuagu cacg uua  a
     |||||||||| ||||||| |||| |||  u
3'   ugcucacauu gagauca gugc gau  u
   ac          -       -    u   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence api-miR-996

Accession MIMAT0014746
Sequence

40 - 

gugacuagaguuacacucguc

 - 60

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).