Stem-loop sequence api-mir-3022

AccessionMI0013965 (change log)
DescriptionAcyrthosiphon pisum miR-3022 stem-loop
Stem-loop
   --uc   uua      a   c    -aa     u 
5'     ucg   uaucug cgu gggg   uggua a
       |||   |||||| ||| ||||   |||||  
3'     agc   auagau gcg ccuc   accau u
   gcgu   -uc      -   a    aag     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349928.1: 465371-465435 [+]
intergenic
Database links

Mature sequence api-miR-3022

Accession MIMAT0014758
Sequence

1 - 

ucucguuauaucugacgucggggaa

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).