Stem-loop sequence api-mir-3043-1

AccessionMI0013994 (change log)
DescriptionAcyrthosiphon pisum miR-3043-1 stem-loop
Gene family MIPF0001110; mir-3043
Stem-loop
   --        u      uu     cug  cua 
5'   ucaguaug guccuu  augug   ug   u
     |||||||| ||||||  |||||   ||   a
3'   gguuauac caggaa  uacac   ac   u
   ga        u      -u     aaa  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349650.1: 609772-609835 [-]
intergenic
Clustered miRNAs
< 10kb from api-mir-3043-1
api-mir-3043-3GL349650.1: 612449-612512 [-]
api-mir-3043-2GL349650.1: 611113-611176 [-]
api-mir-3043-1GL349650.1: 609772-609835 [-]
Database links

Mature sequence api-miR-3043

Accession MIMAT0014781
Sequence

42 - 

cacauuaaggacucauauuggag

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).