Stem-loop sequence api-mir-2796

AccessionMI0014008 (change log)
DescriptionAcyrthosiphon pisum miR-2796 stem-loop
Stem-loop
   --   u     aa       uca    c   aa 
5'   agu guuuc  ccggucu   gcga uau  a
     ||| |||||  |||||||   |||| |||   
3'   uca caaag  ggccgga   uguu gua  a
   ga   u     gc       ---    u   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350032.1: 229555-229617 [-]
intergenic
Database links

Mature sequence api-miR-2796

Accession MIMAT0014790
Sequence

42 - 

guaggccggcggaaacuacuag

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).