MIR466 is a miRNA that has been found to have five potential target genes that are differentially expressed in patients with age-related macular degeneration (AMD) compared to unaffected individuals [PMC5429617]. A previous study identified 17 new miRNAs, including MIR466, which belong to 11 miRNA families and can regulate 64 sorghum genes involved in various cellular processes [PMC5360763]. Among these processes are cell cycle regulation, metabolism, protein degradation, RNA processing, stress response, and transportation [PMC5360763]. MIR466 is also involved in the regulation of matrix metalloproteinase-9 (MMP9) expression and can downregulate its expression by binding to the 3' UTR region of MMP9 [PMC4568920]. Inhibition of MIR466 has been achieved using a specific inhibitor (AM18443) in endothelial cells (ECs), along with other miRNA inhibitors [PMC9307898]. Additionally, MIR466 has been shown to regulate expression of MMP9 in diabetic heart tissue and promote proliferation of ECs and formation of capillary-like structures [PMC8355361]. Overall, these findings highlight the importance of MIR466 in various biological processes and its potential as a therapeutic target for diseases such as AMD and diabetes-related heart damage.
a a uau guguguguauauguguguugc ugugugu uaugugug a ||||||||||||||||||||| ||||||| |||||||| cguacauauaUACACACAACG ACAUACA AUAcacau u C C gua
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0015002 |
Description | Homo sapiens hsa-miR-466 mature miRNA |
Sequence | 52 - AUACACAUACACGCAACACACAU - 74 |
Evidence |
experimental
Illumina [1-2] |
Database links | |
Predicted targets |
|