Stem-loop sequence hsa-mir-3160-2

Accession

MI0014190 (change log)

Symbol

HGNC:MIR3160-2

Description

Homo sapiens miR-3160-2 stem-loop

Gene family

MIPF0001028; mir-3160

Literature search

1 open access papers mention hsa-mir-3160-2
(2 sentences)

Stem-loop

                                    ga       
5' accugcccugggcuuucuagucucagcucuccu  ccagcu 
   |||||||||||||||||||||||||||||||||  ||||| g
3' uggacgggacccgaaagaucagagucgagagga  ggucga 
                                    --       

Deep sequencing

165 reads, 1.54 reads per million, 65 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr11: 46451807-46451887 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000390102 ; AMBRA1-001; intron 13

  OTTHUMT00000390154 ; AMBRA1-007; intron 13

  OTTHUMT00000390100 ; AMBRA1-002; intron 14

  OTTHUMT00000390103 ; AMBRA1-005; intron 14

  OTTHUMT00000390099 ; AMBRA1-006; intron 15

  ENST00000534300 ; AMBRA1-001; intron 13

  ENST00000528950 ; AMBRA1-007; intron 13

  ENST00000426438 ; AMBRA1-202; intron 13

  ENST00000298834 ; AMBRA1-201; intron 13

  ENST00000533727 ; AMBRA1-002; intron 14

  ENST00000458649 ; AMBRA1-005; intron 14

  ENST00000314845 ; AMBRA1-006; intron 15

Clustered miRNAs

< 10kb from hsa-mir-3160-2

• hsa-mir-3160-1: chr11: 46451805-46451889 [-]
• hsa-mir-3160-2: chr11: 46451807-46451887 [+]

Database links

• EntrezGene:MIR3160-2
• HGNC:MIR3160-2
• RNAcentral:URS000075D29F_9606
• miRBase Tracker:MI0014190

Mature sequence hsa-miR-3160-5p

• Accession: MIMAT0019212
• Sequence: 11 - ggcuuucuagucucagcucucc - 32
• Deep sequencing: 30 reads, 13 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetMiner:hsa-miR-3160-5p
  • TargetScanVert:hsa-miR-3160-5p
  • miRDB:hsa-miR-3160-5p

Mature sequence hsa-miR-3160-3p

• Accession: MIMAT0015034
• Previous IDs: hsa-miR-3160
• Sequence: 52 - agagcugagacuagaaagccca - 73
• Deep sequencing: 256 reads, 51 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS0000086029_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3160-3p
  • TargetScanVert:hsa-miR-3160-3p
  • miRDB:hsa-miR-3160-3p
  • microrna.org:hsa-miR-3160-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).