Stem-loop sequence bmo-mir-3351

AccessionMI0014409 (change log)
DescriptionBombyx mori miR-3351 stem-loop
Gene family MIPF0000847; mir-3267
Literature search

1 open access papers mention bmo-mir-3351
(2 sentences)

Stem-loop
   -    --cgcau     -    --g  --u      g   --gcc   a 
5'  guag       uuacg uugu   ga   gucuau ggc     agu a
    ||||       ||||| ||||   ||   |||||| |||     |||  
3'  cauc       agugc aaca   uu   cgggug ucg     uca c
   u    uuuuauu     u    aaa  ugu      g   acaau   u 
Get sequence
Deep sequencing
541 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582023.1: 4826212-4826301 [-]
intergenic
NW_004582427.1: 3282-3371 [+]
intergenic
NW_004621618.1: 320-409 [+]
intergenic
Database links

Mature sequence bmo-miR-3351

Accession MIMAT0015536
Sequence

10 - 

uuacguuguggaugucuaugggc

 - 32

Get sequence
Deep sequencing514 reads, 3 experiments
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).