![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-3432a-1 |
|||||
Accession | MI0014500 (change log) | ||||
Previous IDs | bta-mir-3432-1 | ||||
Description | Bos taurus miR-3432a-1 stem-loop | ||||
Gene family | MIPF0001187; mir-3432 | ||||
Literature search |
3 open access papers mention bta-mir-3432a-1 | ||||
Stem-loop |
-c - ugu g --u ug - u ca 5' uucgaucuuug ucaugg gc ggaucuu aguug g ug g a ||||||||||| |||||| || ||||||| ||||| | || | 3' agguuaggaac aguacc ug ccuaggg ucgac u ac c a cc c --u a ugu gu g u uc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Jin et al. predicted this miRNA bioinformatically in [1], and validated its expression by qPCR in [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-3432a |
|
Accession | MIMAT0017396 |
Previous IDs | bta-miR-3432 |
Sequence |
21 - ugcgggaucuuuaguuguggug - 42 |
Deep sequencing | 9409 reads, 68 experiments |
Evidence | experimental; qPCR [2], Illumina [3] |
Predicted targets |
|
References |
|
1 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|
2 |