Stem-loop sequence aly-MIR396a

AccessionMI0014581 (change log)
DescriptionArabidopsis lyrata miR396a stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
      acg    c  c       uc            c            a -u  -uu    uuuguuuuuuuuauauauaugucuua 
5' ucu   ugac cu ucuguau  uuccacagcuuu uugaacugcaaa c  uc   caga                          c
   |||   |||| || |||||||  |||||||||||| |||||||||||| |  ||   ||||                           
3' aga   acug ga aggcaua  agggugucgaaa aacuuggcguuu g  ag   gucu                          g
      --a    a  c       ga            u            a uu  cuc    cuacacuuguuuuugugauaaaauac 
Get sequence
Deep sequencing
1484 reads, 4.75e+04 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 17432895-17433066 [-]
intergenic
Database links

Mature sequence aly-miR396a-5p

Accession MIMAT0017557
Previous IDsaly-miR396a
Sequence

24 - 

uuccacagcuuucuugaacug

 - 44

Get sequence
Deep sequencing760 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence aly-miR396a-3p

Accession MIMAT0017558
Previous IDsaly-miR396a*
Sequence

133 - 

guucaauaaagcugugggaag

 - 153

Get sequence
Deep sequencing724 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).