Stem-loop sequence aly-MIR833

AccessionMI0014609 (change log)
DescriptionArabidopsis lyrata miR833 stem-loop
Gene family MIPF0001186; MIR833
Stem-loop
            -       a   c         aa     a uc   c a   g          a     a             a  c   ac                    a   cuuuucauccuugaaauucucugcaauuacaagguugaacuuuuuuucaaccaagggcucacaccgcacuaggacucauacuauuaccuuacucuugugac 
5' ucuagaggg uggugca cau ucuggaugu  auggu c  uua a aug ugauggugaa agaaa ggagcagcuuguu gu uga  ucggucuaguucaaaccaaa cau                                                                                                     a
   ||||||||| ||||||| ||| |||||||||  ||||| |  ||| | ||| |||||||||| ||||| ||||||||||||| || |||  |||||||||||||||||||| |||                                                                                                      
3' agaucuccc accacgu gua agaccugca  uacca g  aau u uac acuaccacuu ucuuu cuucgucgaacaa ca acu  agccagaucaaguuugguuu gua                                                                                                     a
            c       c   a         gc     c uu   u c   a          a     g             a  -   gu                    -   uacaaagagacguuaauaacccgacuugaaaagaaguguacuguaauccugggcaugggguuugaaggagguugggcuuugcauagagaaauuacguuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 18210551-18210981 [+]
intergenic
Database links

Mature sequence aly-miR833-5p

Accession MIMAT0017615
Sequence

78 - 

uguuagucugaacucggucuagu

 - 100

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR833-3p

Accession MIMAT0017616
Sequence

334 - 

uagaccgaugucaacaaacaag

 - 355

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).