Stem-loop sequence aly-MIR835

AccessionMI0014611 (change log)
DescriptionArabidopsis lyrata miR835 stem-loop
Gene family MIPF0001136; MIR835
Stem-loop
   gaugcaaugcuagauggucaucuuugugguuaagcucuuucuugcauauguucuuuaucucuauugauugauauuuuucagcgagcaacauuauauauauauauauaua                     aauuuuu    -----    -c      -aua  c    u   a         g    caac     c           cacaaagcuuaucaug 
5'                                                                                                              uuuuaccuggauuuguaagau       agau     uucu  gacguu    cg aaca uau auuucuguu uagu    uucug ugcaacccauc                c
                                                                                                                |||||||||||||||||||||       ||||     ||||  ||||||    || |||| ||| ||||||||| ||||    ||||| |||||||||||                g
3'                                                                                                              aagauggaccuaaacauucua       ucua     aaga  cugcaa    gu uugu aua ugaagauaa auca    aagau acguuggguag                a
   ---uugagaaguuuaucuuacaaacuagucgaaacacaaaucuugagaaagaacgcauagaagaaguuuaaauaucuaacaauaaaaguuguucguuggaguauaagag                     caaauau    uagcc    aa      aaag  -    u   g         a    cuac     a           cucuuucacaaauuag 
Get sequence
Deep sequencing
2 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 16982982-16983423 [-]
intergenic
Database links

Mature sequence aly-miR835-5p

Accession MIMAT0017619
Sequence

39 - 

uucuugcauauguucuuuauc

 - 59

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR835-3p

Accession MIMAT0017620
Sequence

379 - 

ugaagaagauacgcaagaaag

 - 399

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).