Stem-loop sequence aly-MIR844

AccessionMI0014616 (change log)
DescriptionArabidopsis lyrata miR844 stem-loop
Gene family MIPF0001197; MIR844
Stem-loop
      u   aag ug    uug   ug    a     u g                                      ug auuuug    u   u 
5' gag aua   u  uaag   guu  auga ucuuu a auugaagaaaagaaggacuaguaagauggcuuauaagc  g      agag gag g
   ||| |||   |  ||||   |||  |||| ||||| | ||||||||||||||||||||||||||||||||||||||  |      |||| |||  
3' cuc ugu   g  auuu   caa  uacu agggg u uaacuucuuuucuuucugaucauucuaccgaauauucg  u      ucuu cuc a
      -   -aa ga    uga   --    -     - g                                      gu -acgca    -   g 
Get sequence
Deep sequencing
201 reads, 6e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 1803605-1803786 [-]
intergenic
Database links

Mature sequence aly-miR844-5p

Accession MIMAT0017629
Previous IDsaly-miR844
Sequence

49 - 

agaaggacuaguaagauggcu

 - 69

Get sequence
Deep sequencing138 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence aly-miR844-3p

Accession MIMAT0017630
Previous IDsaly-miR844*
Sequence

122 - 

ccaucuuacuagucuuucuuu

 - 142

Get sequence
Deep sequencing62 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).