Stem-loop sequence aly-MIR858

AccessionMI0014624 (change log)
DescriptionArabidopsis lyrata miR858 stem-loop
Gene family MIPF0001138; MIR858
Stem-loop
        ga         a   -u g     a     u   caa    ---a  u    u      ug                        cucgaucucuccuuaaaacccuaauacguuaucguuuauuucauucaucuauccuucuuaugaucaucauacaugguaucgguuuaugauugaugggguagauagaugaucgaaacuuuugauuucugaggcuuuuuuuuuuuuuuuaaacauuuaguauaccagauauuacuaguacacacauacauacugacacgauagucuauuugaugauuaagucuuuacguucguauacauacggauuucccuuucuuuugcauaaaaucuuagauuaucguaggcaugcggauuuacaauaagaaagaugauugucuauggaauuuaaugacauaaaaggaccuaaaauauggaaaccuucuucuguaaaucauuugaaugauu 
5' agagu  uuggauucg ugc  a gcuug caaag gag   ucuu    ug guuc caucuu  uuucguugucuguucgaccuuggu                                                                                                                                                                                                                                                                                                                                                                                             c
   |||||  ||||||||| |||  | ||||| ||||| |||   ||||    || |||| ||||||  ||||||||||||||||||||||||                                                                                                                                                                                                                                                                                                                                                                                             g
3' uuuca  aacuuaagu acg  u ugaac guuuc cuc   aggg    ac caag guagaa  gaagcaacagacgagcuggaaccg                                                                                                                                                                                                                                                                                                                                                                                             g
        aa         c   uu g     a     -   auc    cuag  -    -      ua                        aaacugaaauuguaguguaaauugaaagaaaaaaacaauuauguagucuacauugaagggaggugucuuaauuuuaauuuuuuuuuuuuucauuuuuuuuuuguauagcuaugccccuuuuaccucuaguuuacuggaauccuuaauugcugagauuauuugacauaugaaacaauaacgaugaaaaaguuagaguacuauagguauauguuauggucgugucaauuaguacauaugcauauacaaauacgaguaccaaaacgaauacacaaauaaguaguucgcguacgaaucaauguaccuugagagagugcaguuauacauuauuacaucagagauguacuuugauaggauaagccaccuuauauauaaaaggagguu 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 14734032-14734969 [-]
intergenic
Database links

Mature sequence aly-miR858-5p

Accession MIMAT0017645
Previous IDsaly-miR858
Sequence

63 - 

uuucguugucuguucgaccuu

 - 83

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR858-3p

Accession MIMAT0017646
Previous IDsaly-miR858*
Sequence

857 - 

ggucgagcagacaacgaagau

 - 877

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).