Stem-loop sequence aly-MIR163

AccessionMI0014640 (change log)
DescriptionArabidopsis lyrata miR163 stem-loop
Gene family MIPF0001116; MIR163
Stem-loop
   ---gugggaga  agu    -uc          cc     c          a           - -    c    a         aa         caa    cucuuacaggaacuuccuccaggcagaagauacugucuugcgaaguuccggguuccuucuucguccgugagucaugaucaagauacgcuuucuugaccacaugguugaaccagugcaaugcauguug 
5'            ca   accu   gagaaaccgg  aaaac cgguggauaa aucgaguucca g ccuc ucag gacuuuagc  caacgauuu   cacu                                                                                                                               c
              ||   ||||   ||||||||||  ||||| |||||||||| ||||||||||| | |||| |||| |||||||||  |||||||||   ||||                                                                                                                                
3'            gu   uggg   cucuuuggcc  uuuug gccaccuauu uagcucaaggu c ggag aguu cugaagucg  guugcuaaa   guga                                                                                                                               u
   uauuuuauaaa  -gu    ugu          ua     c          c           u a    a    g         ga         uuc    accuaaucguuuuagcgccaaggaagaagcuguauucucaaagguguauccucaguaguuaaugcgcaagguaaaguggagguuuuagggguuucccuaguuuuuggcgcugagaggguacaccuug 
Get sequence
Deep sequencing
11 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 11750816-11751270 [+]
intergenic
Database links

Mature sequence aly-miR163-5p.1

Accession MIMAT0017677
Previous IDsaly-miR163.1*
Sequence

51 - 

cgaguuccagccuccucaga

 - 70

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR163-5p.2

Accession MIMAT0017678
Previous IDsaly-miR163.2*
Sequence

71 - 

gacuuuagcaacaacgauuuc

 - 91

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR163-3p.2

Accession MIMAT0017679
Previous IDsaly-miR163.2
Sequence

362 - 

aaucguugaggcugaagucgu

 - 382

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR163-3p.1

Accession MIMAT0017680
Previous IDsaly-miR163.1
Sequence

383 - 

ugaagaggacuuggaacucgauc

 - 405

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).