Stem-loop sequence aly-MIR853

AccessionMI0014647 (change log)
DescriptionArabidopsis lyrata miR853 stem-loop
Gene family MIPF0001182; MIR853
Stem-loop
   ---------------------------------------------------------------------------aggguaaagcguuccugcugcuauccuuuuccuguugcagaagccauuaaauaucuuucucuucugggucuc        cug    au            caa  a     -              a          uuc  c     guuuu  aaga 
5'                                                                                                                                                    aagagcac   cguu  uaucaaguuuuu   gu ucucu uaaagaacuuuggg uuucaagauc   uc uagau     gg    a
                                                                                                                                                      ||||||||   ||||  ||||||||||||   || ||||| |||||||||||||| ||||||||||   || |||||     ||     
3'                                                                                                                                                    uucucgug   gcaa  auaguucaaaaa   ca agaga guuuuuugaagccc agaguucuag   ag aucua     cc    g
   ucucaaaguacgacgaggggaaaggccaacgucuucgguccuuuauagcaacucauucaagguaagagguaaaaguuacuagaaaagauuucccauaccaaagguuccucaacaacgacuacguaguauuccuccuuacaacgcaca        uaa    cu            -uc  a     a              -          uaa  a     -auuu  guga 
Get sequence
Deep sequencing
28 reads, 700 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 10691977-10692369 [+]
intergenic
Database links

Mature sequence aly-miR853-5p

Accession MIMAT0017693
Previous IDsaly-miR853*
Sequence

18 - 

cugcuauccuuuuccuguugca

 - 39

Get sequence
Deep sequencing18 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR853-3p

Accession MIMAT0017694
Previous IDsaly-miR853
Sequence

364 - 

caaccggaaaggggagcagca

 - 384

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).