Stem-loop sequence aly-MIR3438

AccessionMI0014654 (change log)
DescriptionArabidopsis lyrata miR3438 stem-loop
Stem-loop
       -uu   -c   u   uc    uuaacuc    aag       ----   uu   ----uu   uucac   uc         c     u   c        c   uc    c  a   c     uaugc    u 
5' cgag   ugu  gga cga  uauu       gggu   cuagauu    uca  cgu      ugu     caa  acaaguuau guuua gcu cauagcuu auc  ugac ca gau uuguu     auaa u
   ||||   |||  ||| |||  ||||       ||||   |||||||    |||  |||      |||     |||  ||||||||| ||||| ||| |||||||| |||  |||| || ||| |||||     ||||  
3' gcuu   aca  ucu guu  auaa       uccg   gaucuag    agu  gcg      aca     guu  uguucaaua caaau cga guaucgaa uag  acug gu cua aacaa     uauu u
       uau   uu   -   cu    cuaauuu    -ga       guuu   uu   uuuaau   -ucuu   ua         -     u   a        u   ga    a  a   a     cauuu    u 
Get sequence
Deep sequencing
11 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 4344618-4344881 [-]
intergenic
Database links

Mature sequence aly-miR3438-3p

Accession MIMAT0017707
Sequence

86 - 

uccauagcuucaucucugacc

 - 106

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR3438-5p

Accession MIMAT0017708
Sequence

155 - 

ucaaggauuaagcuaugaagc

 - 175

Get sequence
Deep sequencing8 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).