Stem-loop sequence aly-MIR3441

AccessionMI0014657 (change log)
DescriptionArabidopsis lyrata miR3441 stem-loop
Stem-loop
          u                 a                          u    a     g            c a            u   c    auuauugacuucacucauaggaguggaacuaggau 
5' guaguuu ugaucuucagcgaagaa augaagucguuuugcuucaaagcauc uuga ggaag gaaaguuaccaa u acguuuaguagc acu aagc                                   a
   ||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||| ||||| |||||||||||| | |||||||||||| ||| ||||                                    
3' caucaaa acuagaagucguuucuu uacuucagcaaaacgaaguuuuguag aacu ccuuc cuuucaaugguu a ugcaaaucaucg ugg uuug                                   u
          u                 c                          u    c     a            a c            -   u    auuaacgaaagaaguguuugaguaucuuucguaag 
Get sequence
Deep sequencing
45 reads, 1.1e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 2062168-2062438 [+]
intergenic
Database links

Mature sequence aly-miR3441-5p.2

Accession MIMAT0017713
Previous IDsaly-miR3441.2*
Sequence

19 - 

cgaagaaaaugaagucguuuu

 - 39

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR3441-5p.1

Accession MIMAT0017714
Previous IDsaly-miR3441.1
Sequence

42 - 

uucaaagcaucuuugaaggaa

 - 62

Get sequence
Deep sequencing20 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence aly-miR3441-3p.1

Accession MIMAT0017715
Previous IDsaly-miR3441.1*
Sequence

212 - 

cccucaaugauguuuugaagc

 - 232

Get sequence
Deep sequencing13 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR3441-3p.2

Accession MIMAT0017716
Previous IDsaly-miR3441.2
Sequence

235 - 

aacgacuucaucuucuuugcu

 - 255

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).