Stem-loop sequence aly-MIR3447

AccessionMI0014663 (change log)
DescriptionArabidopsis lyrata miR3447 stem-loop
Stem-loop
           a  g                a           a  c        cuc   g 
5' guucagag cu auucgugacgaacaua ucaaacgauga ac auuuuaag   auc a
   |||||||| || |||||||||||||||| ||||||||||| || ||||||||   |||  
3' caagucuc ga uaaguauuguuugugu aguuuguugcu ug uaaaauuc   uag g
           a  a                g           c  u        cuu   a 
Get sequence
Deep sequencing
86 reads, 2.4e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 12947001-12947120 [-]
intergenic
Database links

Mature sequence aly-miR3447-5p

Accession MIMAT0017729
Previous IDsaly-miR3447*
Sequence

16 - 

cgugacgaacauaaucaaacg

 - 36

Get sequence
Deep sequencing17 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence aly-miR3447-3p

Accession MIMAT0017730
Previous IDsaly-miR3447
Sequence

87 - 

uuugaguguguuuguuaugaa

 - 107

Get sequence
Deep sequencing62 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).