Stem-loop sequence aly-MIR3449

AccessionMI0014665 (change log)
DescriptionArabidopsis lyrata miR3449 stem-loop
Stem-loop
       --ua                                    g             ucagauuaauaauaug 
5' cuuu    guuuucauucugagauccaauaucuagauugcuuuc gucugucugauug                u
   ||||    |||||||||||||||||||||||||||||||||||| |||||||||||||                 
3' gaga    uaaaaguaagacucuagguuauaggucuaacgaaag uagacagacuaac                u
       ccag                                    a             caacuuugaaacuggu 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 708072-708219 [+]
intergenic
Database links

Mature sequence aly-miR3449-5p

Accession MIMAT0017733
Previous IDsaly-miR3449
Sequence

29 - 

ucuagauugcuuucggucugu

 - 49

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR3449-3p

Accession MIMAT0017734
Previous IDsaly-miR3449*
Sequence

100 - 

agauagaaagcaaucuggaua

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).