Stem-loop sequence gga-mir-3524a

AccessionMI0015376 (change log)
Previous IDsgga-mir-3524
DescriptionGallus gallus miR-3524 stem-loop
Gene family MIPF0001215; mir-3524
Stem-loop
    ug   -u    uuaag   c  ac  a  -   a       a       c    ucua 
5' c  gau  aucu     guc cu  ca cc cgg ccauucu ugauucu ugau    a
   |  |||  ||||     ||| ||  || || ||| ||||||| ||||||| ||||     
3' g  cua  uagg     cag ga  gu gg guc gguaaga gcuaaga acua    a
    gu   cc    -ucua   a  aa  c  a   -       c       c    uuga 
Get sequence
Deep sequencing
117 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 105832017-105832132 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-3524a
gga-mir-3525chr1: 105832033-105832116 [+]
gga-mir-3524achr1: 105832017-105832132 [-]
Database links

Mature sequence gga-miR-3524a

Accession MIMAT0016374
Previous IDsgga-miR-3524
Sequence

68 - 

cagaaucgcagaauggcugagg

 - 89

Get sequence
Deep sequencing77 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19891781 "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).