Stem-loop sequence cin-mir-4026

AccessionMI0015577 (change log)
DescriptionCiona intestinalis miR-4026 stem-loop
Stem-loop
   -   a             uu   ac 
5'  gua gugaugacgucau  gac  g
    ||| |||||||||||||  |||  u
3'  cau cauuacugcagua  cug  c
   g   -             -u   ca 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_89: 466718-466767 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4026
cin-mir-4021scaffold_89: 466265-466321 [+]
cin-mir-4026scaffold_89: 466718-466767 [+]
Database links

Mature sequence cin-miR-4026-5p

Accession MIMAT0016542
Sequence

1 - 

guaagugaugacgucauuug

 - 20

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4026-3p

Accession MIMAT0016543
Sequence

31 - 

ucuaugacgucauuacuacg

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1