Stem-loop sequence cin-mir-4039

AccessionMI0015590 (change log)
DescriptionCiona intestinalis miR-4039 stem-loop
Stem-loop
   u   ug    ug          ua 
5'  aua  aaga  uaagcuauuc  u
    |||  ||||  ||||||||||   
3'  uau  uucu  guuugauaag  a
   u   gu    uu          uu 
Get sequence
Deep sequencing
12994 reads, 4.85e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_65: 663235-663284 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4039
cin-mir-4039scaffold_65: 663235-663284 [+]
cin-mir-4061scaffold_65: 663351-663400 [+]
cin-mir-4037scaffold_65: 663455-663511 [+]
cin-mir-4052scaffold_65: 663557-663606 [+]
Database links

Mature sequence cin-miR-4039-5p

Accession MIMAT0016567
Sequence

1 - 

uauaugaagauguaagcuau

 - 20

Get sequence
Deep sequencing12993 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4039-3p

Accession MIMAT0016568
Sequence

31 - 

auaguuuguuucuuuguauu

 - 50

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1