Stem-loop sequence cin-mir-4052

AccessionMI0015603 (change log)
DescriptionCiona intestinalis miR-4052 stem-loop
Stem-loop
   c   -    ca        a    a 
5'  agg cuug  uuucaagu aguc c
    ||| ||||  |||||||| ||||  
3'  ucc ggac  aaaguuca ucag g
   -   a    cc        c    u 
Get sequence
Deep sequencing
183 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_65: 663557-663606 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4052
cin-mir-4039scaffold_65: 663235-663284 [+]
cin-mir-4061scaffold_65: 663351-663400 [+]
cin-mir-4037scaffold_65: 663455-663511 [+]
cin-mir-4052scaffold_65: 663557-663606 [+]
Database links

Mature sequence cin-miR-4052-5p

Accession MIMAT0016593
Sequence

1 - 

caggcuugcauuucaaguaa

 - 20

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4052-3p

Accession MIMAT0016594
Sequence

31 - 

ucacuugaaacccaggaccu

 - 50

Get sequence
Deep sequencing178 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1