Stem-loop sequence cin-mir-4056

AccessionMI0015607 (change log)
DescriptionCiona intestinalis miR-4056 stem-loop
Stem-loop
   ac   u            au    aaa 
5'   uga guagaacaaggc  gcgc   c
     ||| ||||||||||||  ||||    
3'   acu caucuuguucug  cgcg   a
   cc   -            --    cca 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
5q: 863632-863684 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4056
cin-mir-40865q: 864977-865032 [-]
cin-mir-40705q: 864845-864902 [-]
cin-mir-40665q: 864513-864560 [-]
cin-mir-40855q: 863886-863941 [-]
cin-mir-40565q: 863632-863684 [-]
Database links

Mature sequence cin-miR-4056-5p

Accession MIMAT0016601
Sequence

1 - 

acugauguagaacaaggcaugcg

 - 23

Get sequence
Deep sequencing84 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4056-3p

Accession MIMAT0016602
Sequence

34 - 

cgcgucuuguucuacucacc

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1