Stem-loop sequence cin-mir-4064

AccessionMI0015615 (change log)
DescriptionCiona intestinalis miR-4064 stem-loop
Stem-loop
   -a u    a    -    a     ua 
5'   g cagg uuac gguu guuuu  a
     | |||| |||| |||| |||||   
3'   c gucc aaug ccaa caaaa  a
   gc u    c    g    -     uc 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
8q: 6232164-6232214 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4064
cin-mir-40648q: 6232164-6232214 [+]
cin-mir-40728q: 6232569-6232622 [+]
Database links

Mature sequence cin-miR-4064-5p

Accession MIMAT0016616
Sequence

1 - 

agucaggauuacgguuaguuuu

 - 22

Get sequence
Deep sequencing43 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4064-3p

Accession MIMAT0016617
Sequence

31 - 

aacaaccgguaacccuguccg

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1