Stem-loop sequence cin-mir-4066

AccessionMI0015617 (change log)
DescriptionCiona intestinalis miR-4066 stem-loop
Stem-loop
   cca         c            
5'    gauguggug aggcaugcgaa 
      ||||||||| |||||||||| a
3'    cuguacuau uccguacguug 
   -gc         u            
Get sequence
Deep sequencing
18 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
5q: 864513-864560 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4066
cin-mir-40865q: 864977-865032 [-]
cin-mir-40705q: 864845-864902 [-]
cin-mir-40665q: 864513-864560 [-]
cin-mir-40855q: 863886-863941 [-]
cin-mir-40565q: 863632-863684 [-]
Database links

Mature sequence cin-miR-4066-5p

Accession MIMAT0016620
Sequence

1 - 

ccagauguggugcaggcaugcg

 - 22

Get sequence
Deep sequencing18 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4066-3p

Accession MIMAT0016621
Sequence

30 - 

caugccuuuaucauguccg

 - 48

Get sequence
Evidence experimental; Illumina [1]

References

1