Stem-loop sequence cin-mir-4072

AccessionMI0015623 (change log)
DescriptionCiona intestinalis miR-4072 stem-loop
Stem-loop
   --      uu    c          -  a 
5'   uuuguu  aagg uucauuuucu ac a
     ||||||  |||| |||||||||| ||  
3'   aaacag  uucu agguaaaaga ug a
   ca      --    -          c  u 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
8q: 6232569-6232622 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4072
cin-mir-40648q: 6232164-6232214 [+]
cin-mir-40728q: 6232569-6232622 [+]
Database links

Mature sequence cin-miR-4072-5p

Accession MIMAT0016632
Sequence

1 - 

uuuguuuuaaggcuucauuuucu

 - 23

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4072-3p

Accession MIMAT0016633
Sequence

35 - 

aaaauggaucuugacaaaac

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1