Stem-loop sequence cin-mir-4073

AccessionMI0015624 (change log)
DescriptionCiona intestinalis miR-4073 stem-loop
Stem-loop
            a   u c       uc 
5' acgacaagu ggg c uuuugcg  a
   ||||||||| ||| | |||||||  c
3' uguuguuca cuu g aggacgc  c
            g   - u       ua 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
13q: 2009067-2009118 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4073
cin-mir-407313q: 2009067-2009118 [-]
cin-mir-404613q: 2008717-2008774 [-]
Database links

Mature sequence cin-miR-4073-5p

Accession MIMAT0016634
Sequence

1 - 

acgacaaguaggguccuuuu

 - 20

Get sequence
Deep sequencing62 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4073-3p

Accession MIMAT0016635
Sequence

33 - 

caggauguucgacuuguugu

 - 52

Get sequence
Deep sequencing22 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1