Stem-loop sequence cin-mir-4085

AccessionMI0015638 (change log)
DescriptionCiona intestinalis miR-4085 stem-loop
Stem-loop
   u    c    ug   g  -      aaua 
5'  cgca guug  cag ca agcagg    g
    |||| ||||  ||| || ||||||     
3'  gugu uaac  guu gu ucgucc    a
   -    -    cu   -  g      aaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
5q: 863886-863941 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4085
cin-mir-40865q: 864977-865032 [-]
cin-mir-40705q: 864845-864902 [-]
cin-mir-40665q: 864513-864560 [-]
cin-mir-40855q: 863886-863941 [-]
cin-mir-40565q: 863632-863684 [-]
Database links

Mature sequence cin-miR-4085-5p

Accession MIMAT0016659
Sequence

1 - 

ucgcacguugugcaggcaagc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4085-3p

Accession MIMAT0016660
Sequence

37 - 

ugcuguguuguccaauugug

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1