Stem-loop sequence cin-mir-4112

AccessionMI0015666 (change log)
DescriptionCiona intestinalis miR-4112 stem-loop
Stem-loop
   --      u    uug      --  uu    uu 
5'   auacau cauu   acauac  ua  ggca  g
     |||||| ||||   ||||||  ||  ||||  u
3'   uaugua guag   uguaug  au  uugu  a
   gg      -    uaa      ua  uu    uc 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 6021165-6021230 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4112
cin-mir-41124q: 6021165-6021230 [+]
cin-mir-4179b4q: 6025879-6025952 [+]
Database links

Mature sequence cin-miR-4112-5p

Accession MIMAT0016701
Sequence

1 - 

auacauucauuuugacauac

 - 20

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4112-3p

Accession MIMAT0016702
Sequence

47 - 

uauguaaugaugauguaugg

 - 66

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1