Stem-loop sequence cin-mir-4165

AccessionMI0015720 (change log)
DescriptionCiona intestinalis miR-4165 stem-loop
Stem-loop
   u       ccac      a    cau 
5'  gucccau    ccuacu uaug   a
    |||||||    |||||| ||||    
3'  cagggua    ggguga guac   u
   a       aaac      -    aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1p: 1541154-1541206 [+]
intergenic
1q: 4740167-4740219 [+]
intergenic
Database links

Mature sequence cin-miR-4165-3p

Accession MIMAT0016773
Sequence

34 - 

ugagugggcaaaaugggaca

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1