Stem-loop sequence cin-mir-4181

AccessionMI0015737 (change log)
DescriptionCiona intestinalis miR-4181 stem-loop
Stem-loop
                 u          
5' auugugucagccug cguucuaga 
   |||||||||||||| |||||||| a
3' uaacacagucggac gcaagauua 
                 u          
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
3q: 3055652-3055700 [+]
intergenic
Database links

Mature sequence cin-miR-4181-5p

Accession MIMAT0016794
Sequence

1 - 

auugugucagccugucguucu

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4181-3p

Accession MIMAT0016795
Sequence

30 - 

gaacgucaggcugacacaau

 - 49

Get sequence
Evidence experimental; Illumina [1]

References

1