Stem-loop sequence cin-mir-4005c

AccessionMI0015741 (change log)
DescriptionCiona intestinalis miR-4005c stem-loop
Stem-loop
   -u          -g uu     --a     
5'   gaguugguau  u  cuggu   guac 
     ||||||||||  |  |||||   ||| u
3'   uucgaccaug  g  gauca   caug 
   ac          aa gg     cug     
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
3q: 1937694-1937748 [+]
intergenic
Database links

Mature sequence cin-miR-4005c-5p

Accession MIMAT0016801
Sequence

1 - 

ugaguugguauguuucuggu

 - 20

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1