Stem-loop sequence aly-MIR4221

AccessionMI0015782 (change log)
DescriptionArabidopsis lyrata miR4221 stem-loop
Gene family MIPF0001128; MIR4221
Stem-loop
   ---cua    a    u     g     -                 c       u    ugau   uaaug  ua   u 
5'       guau ccag uaaca uuuuc cugcuuuugaauucuug acuagcu ccau    aga     gu  cau u
         |||| |||| ||||| ||||| ||||||||||||||||| ||||||| ||||    |||     ||  |||  
3'       caua gguu auugu agaag gaugaaaacuugagaac ugaucga ggug    ucu     cg  gug u
   auauac    -    u     -     u                 a       u    ---u   --caa  uc   g 
Get sequence
Deep sequencing
25 reads, 600 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 13687003-13687149 [-]
intergenic
Database links

Mature sequence aly-miR4221

Accession MIMAT0017909
Sequence

106 - 

aagaguucaaaaguagugaaga

 - 127

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; SOLiD [1]

References

1