Stem-loop sequence aly-MIR4226

AccessionMI0015787 (change log)
DescriptionArabidopsis lyrata miR4226 stem-loop
Stem-loop
   --aagcaaugaaua            a    c  u                   caugcccucguggcuuuguucuuccaacc 
5'               guacauuguaca gaug au cgagcaauaaaugaguuug                             a
                 |||||||||||| |||| || |||||||||||||||||||                             u
3'               cauguaacaugu uugc ua gcucguuauuuacucaaac                             u
   agaguuaacucaaa            -    u  c                   ccacucccauagucuacuacuguuuguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 1204559-1204724 [+]
intergenic
Database links

Mature sequence aly-miR4226

Accession MIMAT0017914
Sequence

21 - 

uacaagaugcauucgagcaaua

 - 42

Get sequence
Evidence experimental; SOLiD [1]

References

1